Drosophila stocks and clone induction in the wing disc
Fly stocks were maintained at 25 °C with a 12 h light–dark cycle. A list of fly stocks is provided in Supplementary Table 2. Detailed genotypes of all animals for all figure panels are given in Supplementary Table 3. Crosses for temperature-sensitive knockdown experiments using UAS/GAL4/tubulinG80ts were maintained at 18 °C and shifted to 29 °C to induce transgene expression. Crosses used for clone-induction experiments were kept at 18 °C before heat shock for 15-45 min at 35 °C (for Rok and Koi clones) or for 15–25 min at 33 °C (all other clones) during early to mid-third instar larval stages. After heat shock, crosses were kept at 25 °C to facilitate efficient gene expression. Crosses to determine the effect of mild Nej or Hdac1 knockdown on disc and wing growth using enG4 were kept at 18 °C to reduce RNAi efficiency and prevent lethality.
Immunofluorescence staining of Drosophila wing discs
Unless indicated otherwise, immunostainings were performed on wing discs from third instar larvae. Larvae were either dissected in PBS on ice, or incubated in explant cultures (see below)24, and thereafter fixed for 20 min in 4% formaldehyde (FA) and PBS. All subsequent washing and incubation steps were performed with gentle rocking of the carcasses on a rocking platform. Samples were rinsed twice with PBS containing 0.3% Triton X-100 (PBX) followed by 2 washes for 10 min in PBX. Larvae were blocked for 45 min in PBX containing 5% BSA (BBX) before incubation with primary antibodies and Alexa Fluor 488 Phalloidin (Invitrogen, A12379) or Alexa Fluor 633 Phalloidin (Invitrogen, A22284) in BBX overnight at 4 °C. A list of primary and secondary antibodies used in this study is provided in Supplementary Table 4. To remove the primary antibodies, samples were rinsed twice with BBX, followed by 2 washing steps for 60 and 30 min in BBX. The samples were then incubated in BBX containing DAPI (2.5 μg ml–1; AppliChem, A1001) and secondary antibodies (1:250) at room temperature in the dark. Before mounting the wing discs in mounting medium (80% glycerol, 1× PBS and 20 mM n-propyl gallate (Sigma-Aldrich, P3130)), the samples were rinsed twice and then washed 2 times for 30 min each with BBT. Immunofluorescence signals in the tissue were detected by confocal microscopy (Leica SP8 confocal microscope). Sum intensity projections were generated using Fiji.
To align wing disc orientations in the figure panels, some disc images were rotated. The resulting empty corners of the squares were underlaid with solid black boxes for a more consistent panel layout.
Image quantification, data analysis and software
All quantifications were performed using Fiji. For quantification of histone acetylation and total ac-K immunosignals, integrated intensities were normalized to the corresponding DAPI signal and displayed as the ratio of signal of the rim versus the centre of the wing disc. The rim was defined as a region of 10 pixels in thickness starting from the edge of the disc and moving inwards. For the quantification of H3K18ac in Extended Data Fig. 10a,b, a total intensity of the anterior and posterior rim was determined rather than the ratio of rim to centre signal. For quantification of the TMRM signal, integrated intensities were normalized to the corresponding mitoGFP signal and displayed as the ratio of signal of the rim versus the centre of the wing disc. The rim was defined as a region of 13 pixels in thickness starting from the edge of the disc and moving inwards. For quantification of the tubK40ac immunosignal, sum projections were generated for tubK40ac and DAPI images in Fiji and used to measure integrated intensities. Intensities of tubK40ac were normalized to the corresponding DAPI signals. For quantification of the FISH signal, Fiji was used to measure integrated intensities, which were normalized to the corresponding DAPI signals. To combine data from biological replicates, intensities of each replicate were normalized to the average control intensity. To compare intensities or intensity ratios (rim versus centre) between anterior and posterior compartments of the same wing disc, the GFP or the IFP signal was used to identify the compartment boundaries.
For quantification of nuclear ACSS2, H3K18ac and H3 immunosignals, the DAPI signal was used to outline the nucleus, and mean nuclear intensities were measured in this region with Fiji. Additionally, the distance between the most outward-facing part of each nucleus and the outward-facing tissue surface or between the nuclear surface and the surface of the closest mitochondrion were determined. For quantification of nuclear ACSS2 immunosignal in ACSS2-overexpressing discs and control discs (Fig. 6c–f), the values were additionally sorted into three bins (<5 µm, 5–10 µm and >10 µm) and normalized to the average of the <5 µm bin.
Individual data points are given and displayed as whisker plots. Significance was determined by Mann–Whitney test (two-sided), by Kruskal–Wallis test with Dunn’s multiple comparisons test, by two-way ANOVA with Šídák’s multiple comparisons test or Wilcoxon signed-rank test as indicated in the respective figure legends. Pearson correlation coefficient was used to determine correlation of data. Presence of outliers was determined using ROUT.
Data were analysed using Microsoft Excel (v.16 for Mac) or GraphPad Prism (v.9)
FISH
The FISH probes were designed to encompass between 200 and 450 nucleotides of the desired gene transcripts (see Supplementary Table 5 for the sequences of primers used). Addition of a T7 promoter sequence (ccggtaatacgactcactataggg) to the 5′ end of the reverse primer allowed for transcription directly from PCR-amplified fragments using a digoxigenin RNA labeling kit (Roche, 11277073910) according to the manufacturer’s protocol. RNA probes were purified (RNA Clean-up, Macherey–Nagel, 740948) and stored at −20 °C in 50% formamide until used.
For FISH, wandering third instar larvae were dissected in PBS and fixed for 30 min in 4% FA–PBS. Following a rinse in PBS containing 0.1% Tween-20 (PBT), larvae were washed twice for 10 min and 20 min in PBT. Larvae were incubated for 5 min in PBT containing 50% methanol before transferring them to methanol, in which they could be stored for several days at −20 °C. After 5 min incubation in PBT containing 50% methanol, larvae were fixed again for 20 min in 4% FA–PBT. FA was removed by three washes in PBT (each 5 min). The wash buffer was changed to hybridization solution (HS) (50% formamide, 5× SSC (0.75 M sodium chloride and 75 mM sodium citrate dehydrate), 50 µg ml–1 heparin and 0.1% Tween-20) by serial wash steps of 5 min each in HS–PBT dilutions of 30/70, 50/50, 70/30 and 100/0 (v/v). A 10 min wash in HS was followed by 2 h of blocking at 65 °C in HS supplemented with 100 µg ml–1 salmon sperm DNA (Invitrogen, 15632-011). In parallel, 15 ng of FISH probe was denatured in 100 µl blocking buffer for 3 min at 80 °C. After 5 min on ice, the probe was added to the samples and incubated overnight at 65 °C. To remove unbound probe, samples were rinsed once and washed twice for 5 min and 15 min in HS. The buffer was changed back to PBT through serial wash steps of 5 min each in HS–PBT dilutions of 70/30, 50/50 and 30/70 (v/v). Subsequently, larvae were rinsed and washed 3 times for 15 min each in PBT before blocking for 60 min in maleic acid buffer (1 M maleic acid, 1.5 M NaCl; pH 7.5) supplemented with 0.5% (w/v) blocking reagent for nucleic acid hybridization and detection (Roche, 11096176001). Samples were incubated overnight at 4 °C with pre-absorbed (2–3 h incubation with larvae in the absence of FISH probe) anti-digoxigenin Fab fragments conjugated to horseradish peroxidase (Roche, 11207733910). Unbound Fab fragments were removed by 3 rinses and a 10 min wash in PBT. Nuclei were counterstained for 15 min in PBT containing DAPI (2.5 µg ml–1), followed by a wash for 10 min in PBT. To visualize localization of the FISH probes, a TSA Plus Fluorescein kit (Akoya Biosciences, NEL741001KT) was used according to the manufacturer’s protocol. Last, samples were rinsed once and washed twice for 15 min each with PBT before mounting the wing discs in mounting medium. Fluorescent signals in the tissue were detected by confocal microscopy (Leica SP8 confocal microscope). Sum intensity projections were generated using Fiji.
To align wing disc orientations in the figure panels, some disc images were rotated. The resulting empty corners of the squares were underlaid with solid black boxes for a more consistent panel layout.
Live staining of MMP and lipid droplets in Drosophila wing discs
For live imaging of the MMP using TMRM, wing discs from third instar larvae ubiquitously expressing mitoGFP driven by tubulinG4 (tubG4) were dissected in explant medium (see below)24 and transferred into an explant chamber containing the same medium supplemented with TMRM (50 nM; Biomol, ABD-22221) and the indicated inhibitors. The concentration and duration of drug treatments are indicated in the corresponding figure legends. Supplementary Table 6 lists the compounds used in this study. After incubation in the dark, wing discs were mounted on slides in explant medium and imaged using a Leica SP8 confocal microscope.
The genetically encoded mitochondrial pH Sensor Sypher3s-dmito15 allows visualization of the mitochondrial pH and serves as an indicator of the MMP as it is established through a proton gradient. SypHer3s-dmito is based on the hydrogen peroxide sensor Hyper, which consists of a circularly permutated yellow fluorescent protein (YFP) inserted into the regulatory domain of the bacterial hydrogen peroxide sensor OxyR, which features a mutation rendering the sensor insensitive to hydrogen peroxide but retaining sensitivity towards pH25. The sensor has two excitation maxima, with emission around 405 nm being pH-insensitive, whereas emission around 488 nm shows increased intensity with higher pH.
To generate SypHer3s-dmito transgenic flies, the sensor-coding sequence was transferred from a mammalian expression vector (Addgene, 108119)15 into the pUAST-attB vector26, allowing site-directed insertion of the transgene into the fly genome and expression under control of the UAS/GAL4-system (see Supplementary Table 5 for primers used). The transgene was inserted into the VK33 docking site by phiC31-mediated recombination.
For live imaging of the MMP using SypHer3s-dmito, wing discs from third instar larvae expressing the sensor under control of tubG4 were dissected in explant medium (see below)24 and transferred into an explant chamber containing the same medium and the indicated inhibitors. The concentration and duration of drug treatments are indicated in the corresponding figure legends, and a list of compounds is provided in Supplementary Table 6. After incubation in the dark, wing discs were mounted on slides in PBS and imaged using a Leica SP8 confocal microscope. Images are shown in ratiometric configuration as a ratio of emission at 488 nm excitation (pH-sensitive) to 405 nm excitation (pH-insensitive). Darker colours (blue-violet) indicate lower pH and lower MMP, whereas brighter colours (yellow-white) represent higher pH and higher MMP.
Lipid droplets in the wing disc were visualized using BODIPY staining. For this purpose, wing discs from third instar larvae were dissected in explant medium (see below)24 and transferred to explant chambers containing the same medium supplemented with BODIPY (10 μM; Sigma-Aldrich, 790389) and Hoechst 33342 (10 μg ml–1; Sigma-Aldrich, B2261). After incubating for 10 or 30 min in the dark, larvae were rinsed once with PBS before fixation for 20 min in 4% FA. Before mounting the wing discs in mounting medium (80% glycerol, 1× PBS, 20 mM n-propyl gallate (Sigma-Aldrich, P3130)), the larvae were rinsed twice and then washed 2 times for 10 min each with PBS. Fluorescence signals in the tissue were detected by confocal microscopy (Leica SP8 confocal microscope).
To align wing disc orientations in the figure panels, some disc images were rotated. The resulting empty corners of the squares were underlaid with solid blacks for a more consistent panel layout.
Explant cultures
Ex vivo explant cultures were used for drug treatments as well as live stainings of wing discs. Third instar larvae were dissected in explant medium (Schneider’s Drosophila medium (Gibco, 21720024) containing 100 U ml–1 penicillin, 100 μg ml–1 streptomycin (Gibco, 15140122), 1.6 nM juvenile hormone (Sigma-Aldrich, 333725), 5 nM ecdysone (Enzo Life Sciences, LKT-E0813-M010), 8.3 ng ml–1 adenosine deaminase (Roche, 10102105001) and 10 µg ml–1 insulin (Sigma-Aldrich I0516)), which we previously showed maintains wing discs stress-free and proliferative for up to 6 h24. Incubations were performed in explant chambers (mesh basket in a small glass vial) containing explant medium under constant stirring for oxygenation. The concentration and duration of drug treatments are indicated in the corresponding figure legends and Supplementary Table 6 provides a list of compounds used.
Cut&Run
To identify FABO-dependent H3K18ac peaks in the Drosophila genome, Cut&Run20 was performed on wing discs of wandering third instar larvae. Cut&Run is a method to analyse DNA–protein interactions, similar to ChIP–seq. It is based on a fusion protein consisting of protein A, able to bind the primary antibody, and a micrococcal nuclease (MNase), which cuts gDNA around the binding site. These resulting DNA fragments are then isolated and sequenced.
In this study, a previously published Drosophila-optimized Cut&Run protocol was applied27 (https://protocols.io/private/D6B0AD2DC1431A513994A2A05AC59CDA). In brief, wandering third instar larvae were either incubated for 2 h in the presence or absence of 500 µM etomoxir in explant cultures or directly dissected. Wing discs were then bound to concanavalin A-coated magnetic beads (Polysciences, 86057-3) to prevent loss of the discs during subsequent wash steps on a magnetic rack. To allow antibody binding (H3K18ac, 1:500), wing discs were permeabilized with digitonin. After overnight incubation, bound antibodies were decorated with the protein A–MNase fusion protein (Cell Signaling, 40366). DNA digestion was induced by addition of calcium to activate MNAse. Samples were supplemented with yeast spike-in DNA. Released DNA fragments were purified using AmpureXP beads (Agencourt, A63880).
Libraries were prepared using a KAPA Hyper Prep kit (Roche, 7962312001) following the manufacturer’s protocol. In deviation from the protocol, KAPA Pure Beads were replaced by AmpureXP beads. Owing to low sample input in Cut&Run, adapter ligation (TruSeq single indexed DNA adapter (Illumina, 20015960)) was performed for 3 h. The PCR protocol was altered according to a previously published menthod28 to shorten the PCR cycles (10 s at 60 °c) favouring exponential amplification of shorter DNA fragments produced during Cut&Run. For efficient removal of the primer peak from the library, a second post-amplification clean-up was included in the protocol, as suggested by the manufacturer. Sequencing (125 nucleotide paired-end reads, HiSeq2000, Illumina) was performed by the DKFZ Genomics and Proteomics Core Facility.
The galaxy server platform29 was used for data analysis. Adapter sequences were trimmed using Trim Galore! (v.0.6.3) (https://github.com/FelixKrueger/TrimGalore) before aligning read sequences to the Drosophila genome (dm6) by Bowtie2 (v.2.4.2)30,31. Bowtie2 settings were adjusted according to previously published method28 as follows: –local –very-sensitive-local –no-unal –no-mixed –no-discordant –phred33 -I 10 -X 700. Next, read duplicates were removed using MarkDuplicates (v.2.18.2.2) (http://broadinstitute.github.io/picard/). Peak calling was performed using MACS2 callpeak (v.2.1.1.20160309.6)32,33. Finally, differential binding and principal component analysis was assessed using DiffBind (v.2.10.0)34 by grouping the samples according to treatment. Peaks were annotated using ChIPseeker (v.1.18.0)35 with the genome annotation file from Ensembl (dm6, genes and gene prediction). Gene ontology enrichment analysis was performed using the online tool http://www.webgestalt.org.
Generation of fly lines expressing mutant histones
Fly lines expressing mutant histones were generated using a previously published system23. An entry vector for Gateway Cloning (Thermo Fisher Scientific) provided by A. Herzig encoding a histone gene unit (His-GU) was used as a template to simultaneously mutate H3K18 and H4K8 to either H3R18 and H4R8 or to H3Q18 and H4Q8 (see Supplementary Table 5 for primers used). Cloning of the mutant His-GU into three entry vectors (using XhoI and BstBI) allowed generation of a final destination vector containing three mutated His-GUs by Gateway Cloning. This destination vector, optimized per ref. 23, contains recombination sites allowing phiC31-mediated insertion into the fly genome. The transgene was inserted separately into the VK33 and ZH86Fb docking sites. Subsequently, the two transgenic fly lines were recombined, generating a line with 6 His-GU on chromosome III and crossed into a histone null mutant background (HisC).
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
